Review



recombinant proteins 10× tris buffered saline tbs bio rad  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad recombinant proteins 10× tris buffered saline tbs bio rad
    Recombinant Proteins 10× Tris Buffered Saline Tbs Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 553 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/TBS+%2C+Buffer+Tris+Salino/pm42097146-234-8-14
    Average 99 stars, based on 553 article reviews
    recombinant proteins 10× tris buffered saline tbs bio rad - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Microscopy:

    Article Title: SYK coordinates neuroprotective microglial responses in neurodegenerative disease.
    Article Snippet: YwkJKi-B3_Q Experimental models: Organisms/strains Mouse: 5xFAD; B6SJL-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax The Jackson Laboratory Jax Stock no. 034840-JAX Mouse: B6.129P2-Syktm1.2Tara/J The Jackson Laboratory Jax Stock no. 017309-JAX Mouse: B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2)Jung/J The Jackson Laboratory Jax stock no. 020940-JAX Mouse: B6.Cg-Gt(ROSA)26Sortm6(CAG-Zsgreen1)Hze/J The Jackson Laboratory Jax stock no. 007906-JAX Oligonucleotides qPCR primer: Sykb Thermo Fisher Scientific Mm01333035_m1 qPCR primer: Gapdh Thermo Fisher Scientific Mm99999915_g1 Software and algorithms GraphPad Prism 9 GraphPad RRID: SCR_002798 Imaris 9.5.1 Imaris RRID: SCR_007370 Adobe Photoshop Adobe https://www.adobe.com/ products/photoshop/ BioRender BioRender RRID: SCR_018361 LAS AF Software Leica https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/ Fiji/ImageJ Software Fiji RRID: SCR_002285 Noldus Ethovision XT Software Noldus https://www.noldus.com/ ethovision-xt Kaluza Acquisition Software Beckman Coulter https://www.beckman.com/ flow-cytometry/software/kaluza FlowJo Software FloJo RRID:SCR_008520 Bio-Plex Manager software Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems R Studio (V4.0.5) https://rstudio.com/ RRID:SCR_001905 R https://www.r-project.org RRID:SCR_001905 DESeq2 (v1.32.0) N/A https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Cell Ranger (V1.3.1) N/A https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat (v4.0.2) https://www.r-project.org/ RRID:SCR_016341 ToppCluster Cincinnati Children’s https://toppcluster.cchmc.org Monocle (v0.2.3.0) N/A N/A (Continued on next page) ll OPEN ACCESS e4 Cell 185, 4135–4152.e1–e11, October 27, 2022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle

    Article Title: A framework to validate fluorescently labeled DNA-binding proteins for single-molecule experiments.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER His6-SUMO-BsParB(WT) amp Graham et al.23 pTG011 (=m0041) pelB::Psoj-spo0J-R80A(DparS)-mgfpmut3 tet This paper pWX1104 His6-SUMO-BsParB(R80A) amp Graham et al.23 pTG037 (=m0042) His6-SUMO-KCK-BsParB(WT) amp Graham et al.23 pTG042 (=m0043) His6-SUMO-KCK-BsParB(R80A) amp Graham et al.23 pTG044 (=m0044) His6-SUMO-ECE-BsParB(WT) amp This paper m0064 His6-SUMO-BsParB(WT)-KCK amp This paper m0067 His6-SUMO-BsParB(R80A)-KCK amp This paper m0069 His6-SUMO-ECE-BsParB(R80A) amp This paper m0070 pelB::Psoj-soj-spo0J-R80A(DparS) cat Graham et al.23 pTG122 Software and algorithms MicroManager Edelstein et al.60 https://micro-manager.org Fiji Schindelin et al.61 https://imagej.net/Fiji MATLAB codes used in single-molecule data analyses Kim et al.14 N/A MetaMorph Molecular Devices https://www.moleculardevices.com/ AlphaView ProteinSimple https://proteinsimple.jp/imaging-crunch- some-numbers CLC Genomics Workbench Qiagen https://www.qiagen.com/us/products/discovery- and-translational-research/next-generationsequencing/informatics-and-data/analysisand-visualization/clc-genomics-workbench Other Lambda DNA (dam-) New England Biolabs Cat#N3013S Micro Bio-Spin P-30 Gel Columns, Tris Buffer Bio-Rad Cat7326223 IX-83 total internal reflection fluorescence (TIRF) microscope Olympus (Evident) https://www.olympus-lifescience.com/ Ti2 microscope Nikon instruments https://www.microscope.healthcare.nikon.com/ OptoSplit II Cairn Research https://www.cairn-research.co.uk/product/ optosplit-ii/ T660lpxrxt (Dichroic) Chroma Technology Corp. https://www.chroma.com/ ET705/72m (Emission filter) Chroma Technology Corp. https://www.chroma.com/ ET585/65m (Emission filter) Chroma Technology Corp. https://www.chroma.com/ Q800R2 water bath sonicator Qsonica https://www.sonicator.com/ ProteinSimple Fluorchem R system Bio-Techne https://www.bio-techne.com/p/imaging/ fluorchem-r-system_92-15313-00 UVP UVsolo touch gel documentation system Analytik Jena https://www.analytik-jena.com/ NextSeq 500 System WGS Solution Illumina https://www.illumina.com/ Protein A magnetic Sepharose beads Cytiva Cat#28951378 4-15% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat#4561086 4-20% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat#4561096 Trans-Blot Turbo Mini 0.2 mm PVDF Transfer Packs Bio-Rad Cat#1704156 ..

    Staining:

    Article Title: SYK coordinates neuroprotective microglial responses in neurodegenerative disease.
    Article Snippet: YwkJKi-B3_Q Experimental models: Organisms/strains Mouse: 5xFAD; B6SJL-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax The Jackson Laboratory Jax Stock no. 034840-JAX Mouse: B6.129P2-Syktm1.2Tara/J The Jackson Laboratory Jax Stock no. 017309-JAX Mouse: B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2)Jung/J The Jackson Laboratory Jax stock no. 020940-JAX Mouse: B6.Cg-Gt(ROSA)26Sortm6(CAG-Zsgreen1)Hze/J The Jackson Laboratory Jax stock no. 007906-JAX Oligonucleotides qPCR primer: Sykb Thermo Fisher Scientific Mm01333035_m1 qPCR primer: Gapdh Thermo Fisher Scientific Mm99999915_g1 Software and algorithms GraphPad Prism 9 GraphPad RRID: SCR_002798 Imaris 9.5.1 Imaris RRID: SCR_007370 Adobe Photoshop Adobe https://www.adobe.com/ products/photoshop/ BioRender BioRender RRID: SCR_018361 LAS AF Software Leica https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/ Fiji/ImageJ Software Fiji RRID: SCR_002285 Noldus Ethovision XT Software Noldus https://www.noldus.com/ ethovision-xt Kaluza Acquisition Software Beckman Coulter https://www.beckman.com/ flow-cytometry/software/kaluza FlowJo Software FloJo RRID:SCR_008520 Bio-Plex Manager software Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems R Studio (V4.0.5) https://rstudio.com/ RRID:SCR_001905 R https://www.r-project.org RRID:SCR_001905 DESeq2 (v1.32.0) N/A https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Cell Ranger (V1.3.1) N/A https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat (v4.0.2) https://www.r-project.org/ RRID:SCR_016341 ToppCluster Cincinnati Children’s https://toppcluster.cchmc.org Monocle (v0.2.3.0) N/A N/A (Continued on next page) ll OPEN ACCESS e4 Cell 185, 4135–4152.e1–e11, October 27, 2022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle

    Flow Cytometry:

    Article Title: SYK coordinates neuroprotective microglial responses in neurodegenerative disease.
    Article Snippet: YwkJKi-B3_Q Experimental models: Organisms/strains Mouse: 5xFAD; B6SJL-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax The Jackson Laboratory Jax Stock no. 034840-JAX Mouse: B6.129P2-Syktm1.2Tara/J The Jackson Laboratory Jax Stock no. 017309-JAX Mouse: B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2)Jung/J The Jackson Laboratory Jax stock no. 020940-JAX Mouse: B6.Cg-Gt(ROSA)26Sortm6(CAG-Zsgreen1)Hze/J The Jackson Laboratory Jax stock no. 007906-JAX Oligonucleotides qPCR primer: Sykb Thermo Fisher Scientific Mm01333035_m1 qPCR primer: Gapdh Thermo Fisher Scientific Mm99999915_g1 Software and algorithms GraphPad Prism 9 GraphPad RRID: SCR_002798 Imaris 9.5.1 Imaris RRID: SCR_007370 Adobe Photoshop Adobe https://www.adobe.com/ products/photoshop/ BioRender BioRender RRID: SCR_018361 LAS AF Software Leica https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/ Fiji/ImageJ Software Fiji RRID: SCR_002285 Noldus Ethovision XT Software Noldus https://www.noldus.com/ ethovision-xt Kaluza Acquisition Software Beckman Coulter https://www.beckman.com/ flow-cytometry/software/kaluza FlowJo Software FloJo RRID:SCR_008520 Bio-Plex Manager software Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems R Studio (V4.0.5) https://rstudio.com/ RRID:SCR_001905 R https://www.r-project.org RRID:SCR_001905 DESeq2 (v1.32.0) N/A https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Cell Ranger (V1.3.1) N/A https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat (v4.0.2) https://www.r-project.org/ RRID:SCR_016341 ToppCluster Cincinnati Children’s https://toppcluster.cchmc.org Monocle (v0.2.3.0) N/A N/A (Continued on next page) ll OPEN ACCESS e4 Cell 185, 4135–4152.e1–e11, October 27, 2022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle

    Spectrophotometry:

    Article Title: SYK coordinates neuroprotective microglial responses in neurodegenerative disease.
    Article Snippet: YwkJKi-B3_Q Experimental models: Organisms/strains Mouse: 5xFAD; B6SJL-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax The Jackson Laboratory Jax Stock no. 034840-JAX Mouse: B6.129P2-Syktm1.2Tara/J The Jackson Laboratory Jax Stock no. 017309-JAX Mouse: B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2)Jung/J The Jackson Laboratory Jax stock no. 020940-JAX Mouse: B6.Cg-Gt(ROSA)26Sortm6(CAG-Zsgreen1)Hze/J The Jackson Laboratory Jax stock no. 007906-JAX Oligonucleotides qPCR primer: Sykb Thermo Fisher Scientific Mm01333035_m1 qPCR primer: Gapdh Thermo Fisher Scientific Mm99999915_g1 Software and algorithms GraphPad Prism 9 GraphPad RRID: SCR_002798 Imaris 9.5.1 Imaris RRID: SCR_007370 Adobe Photoshop Adobe https://www.adobe.com/ products/photoshop/ BioRender BioRender RRID: SCR_018361 LAS AF Software Leica https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/ Fiji/ImageJ Software Fiji RRID: SCR_002285 Noldus Ethovision XT Software Noldus https://www.noldus.com/ ethovision-xt Kaluza Acquisition Software Beckman Coulter https://www.beckman.com/ flow-cytometry/software/kaluza FlowJo Software FloJo RRID:SCR_008520 Bio-Plex Manager software Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems R Studio (V4.0.5) https://rstudio.com/ RRID:SCR_001905 R https://www.r-project.org RRID:SCR_001905 DESeq2 (v1.32.0) N/A https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Cell Ranger (V1.3.1) N/A https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat (v4.0.2) https://www.r-project.org/ RRID:SCR_016341 ToppCluster Cincinnati Children’s https://toppcluster.cchmc.org Monocle (v0.2.3.0) N/A N/A (Continued on next page) ll OPEN ACCESS e4 Cell 185, 4135–4152.e1–e11, October 27, 2022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle

    Real-time Polymerase Chain Reaction:

    Article Title: SYK coordinates neuroprotective microglial responses in neurodegenerative disease.
    Article Snippet: YwkJKi-B3_Q Experimental models: Organisms/strains Mouse: 5xFAD; B6SJL-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax The Jackson Laboratory Jax Stock no. 034840-JAX Mouse: B6.129P2-Syktm1.2Tara/J The Jackson Laboratory Jax Stock no. 017309-JAX Mouse: B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2)Jung/J The Jackson Laboratory Jax stock no. 020940-JAX Mouse: B6.Cg-Gt(ROSA)26Sortm6(CAG-Zsgreen1)Hze/J The Jackson Laboratory Jax stock no. 007906-JAX Oligonucleotides qPCR primer: Sykb Thermo Fisher Scientific Mm01333035_m1 qPCR primer: Gapdh Thermo Fisher Scientific Mm99999915_g1 Software and algorithms GraphPad Prism 9 GraphPad RRID: SCR_002798 Imaris 9.5.1 Imaris RRID: SCR_007370 Adobe Photoshop Adobe https://www.adobe.com/ products/photoshop/ BioRender BioRender RRID: SCR_018361 LAS AF Software Leica https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/ Fiji/ImageJ Software Fiji RRID: SCR_002285 Noldus Ethovision XT Software Noldus https://www.noldus.com/ ethovision-xt Kaluza Acquisition Software Beckman Coulter https://www.beckman.com/ flow-cytometry/software/kaluza FlowJo Software FloJo RRID:SCR_008520 Bio-Plex Manager software Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems R Studio (V4.0.5) https://rstudio.com/ RRID:SCR_001905 R https://www.r-project.org RRID:SCR_001905 DESeq2 (v1.32.0) N/A https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Cell Ranger (V1.3.1) N/A https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat (v4.0.2) https://www.r-project.org/ RRID:SCR_016341 ToppCluster Cincinnati Children’s https://toppcluster.cchmc.org Monocle (v0.2.3.0) N/A N/A (Continued on next page) ll OPEN ACCESS e4 Cell 185, 4135–4152.e1–e11, October 27, 2022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle

    Cytometry:

    Article Title: SYK coordinates neuroprotective microglial responses in neurodegenerative disease.
    Article Snippet: YwkJKi-B3_Q Experimental models: Organisms/strains Mouse: 5xFAD; B6SJL-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax The Jackson Laboratory Jax Stock no. 034840-JAX Mouse: B6.129P2-Syktm1.2Tara/J The Jackson Laboratory Jax Stock no. 017309-JAX Mouse: B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2)Jung/J The Jackson Laboratory Jax stock no. 020940-JAX Mouse: B6.Cg-Gt(ROSA)26Sortm6(CAG-Zsgreen1)Hze/J The Jackson Laboratory Jax stock no. 007906-JAX Oligonucleotides qPCR primer: Sykb Thermo Fisher Scientific Mm01333035_m1 qPCR primer: Gapdh Thermo Fisher Scientific Mm99999915_g1 Software and algorithms GraphPad Prism 9 GraphPad RRID: SCR_002798 Imaris 9.5.1 Imaris RRID: SCR_007370 Adobe Photoshop Adobe https://www.adobe.com/ products/photoshop/ BioRender BioRender RRID: SCR_018361 LAS AF Software Leica https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/ Fiji/ImageJ Software Fiji RRID: SCR_002285 Noldus Ethovision XT Software Noldus https://www.noldus.com/ ethovision-xt Kaluza Acquisition Software Beckman Coulter https://www.beckman.com/ flow-cytometry/software/kaluza FlowJo Software FloJo RRID:SCR_008520 Bio-Plex Manager software Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems R Studio (V4.0.5) https://rstudio.com/ RRID:SCR_001905 R https://www.r-project.org RRID:SCR_001905 DESeq2 (v1.32.0) N/A https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Cell Ranger (V1.3.1) N/A https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat (v4.0.2) https://www.r-project.org/ RRID:SCR_016341 ToppCluster Cincinnati Children’s https://toppcluster.cchmc.org Monocle (v0.2.3.0) N/A N/A (Continued on next page) ll OPEN ACCESS e4 Cell 185, 4135–4152.e1–e11, October 27, 2022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle

    Next-Generation Sequencing:

    Article Title: SYK coordinates neuroprotective microglial responses in neurodegenerative disease.
    Article Snippet: YwkJKi-B3_Q Experimental models: Organisms/strains Mouse: 5xFAD; B6SJL-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax The Jackson Laboratory Jax Stock no. 034840-JAX Mouse: B6.129P2-Syktm1.2Tara/J The Jackson Laboratory Jax Stock no. 017309-JAX Mouse: B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2)Jung/J The Jackson Laboratory Jax stock no. 020940-JAX Mouse: B6.Cg-Gt(ROSA)26Sortm6(CAG-Zsgreen1)Hze/J The Jackson Laboratory Jax stock no. 007906-JAX Oligonucleotides qPCR primer: Sykb Thermo Fisher Scientific Mm01333035_m1 qPCR primer: Gapdh Thermo Fisher Scientific Mm99999915_g1 Software and algorithms GraphPad Prism 9 GraphPad RRID: SCR_002798 Imaris 9.5.1 Imaris RRID: SCR_007370 Adobe Photoshop Adobe https://www.adobe.com/ products/photoshop/ BioRender BioRender RRID: SCR_018361 LAS AF Software Leica https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/ Fiji/ImageJ Software Fiji RRID: SCR_002285 Noldus Ethovision XT Software Noldus https://www.noldus.com/ ethovision-xt Kaluza Acquisition Software Beckman Coulter https://www.beckman.com/ flow-cytometry/software/kaluza FlowJo Software FloJo RRID:SCR_008520 Bio-Plex Manager software Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems R Studio (V4.0.5) https://rstudio.com/ RRID:SCR_001905 R https://www.r-project.org RRID:SCR_001905 DESeq2 (v1.32.0) N/A https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Cell Ranger (V1.3.1) N/A https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat (v4.0.2) https://www.r-project.org/ RRID:SCR_016341 ToppCluster Cincinnati Children’s https://toppcluster.cchmc.org Monocle (v0.2.3.0) N/A N/A (Continued on next page) ll OPEN ACCESS e4 Cell 185, 4135–4152.e1–e11, October 27, 2022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle

    Imaging:

    Article Title: SYK coordinates neuroprotective microglial responses in neurodegenerative disease.
    Article Snippet: YwkJKi-B3_Q Experimental models: Organisms/strains Mouse: 5xFAD; B6SJL-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax The Jackson Laboratory Jax Stock no. 034840-JAX Mouse: B6.129P2-Syktm1.2Tara/J The Jackson Laboratory Jax Stock no. 017309-JAX Mouse: B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2)Jung/J The Jackson Laboratory Jax stock no. 020940-JAX Mouse: B6.Cg-Gt(ROSA)26Sortm6(CAG-Zsgreen1)Hze/J The Jackson Laboratory Jax stock no. 007906-JAX Oligonucleotides qPCR primer: Sykb Thermo Fisher Scientific Mm01333035_m1 qPCR primer: Gapdh Thermo Fisher Scientific Mm99999915_g1 Software and algorithms GraphPad Prism 9 GraphPad RRID: SCR_002798 Imaris 9.5.1 Imaris RRID: SCR_007370 Adobe Photoshop Adobe https://www.adobe.com/ products/photoshop/ BioRender BioRender RRID: SCR_018361 LAS AF Software Leica https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/ Fiji/ImageJ Software Fiji RRID: SCR_002285 Noldus Ethovision XT Software Noldus https://www.noldus.com/ ethovision-xt Kaluza Acquisition Software Beckman Coulter https://www.beckman.com/ flow-cytometry/software/kaluza FlowJo Software FloJo RRID:SCR_008520 Bio-Plex Manager software Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems R Studio (V4.0.5) https://rstudio.com/ RRID:SCR_001905 R https://www.r-project.org RRID:SCR_001905 DESeq2 (v1.32.0) N/A https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Cell Ranger (V1.3.1) N/A https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat (v4.0.2) https://www.r-project.org/ RRID:SCR_016341 ToppCluster Cincinnati Children’s https://toppcluster.cchmc.org Monocle (v0.2.3.0) N/A N/A (Continued on next page) ll OPEN ACCESS e4 Cell 185, 4135–4152.e1–e11, October 27, 2022 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Leica TCS SP8 Confocal Microscope Leica Microsystems N/A Mini-PROTEAN TGX Stain-Free Protein Gel Bio-Rad Cat# 4568093 Mini-PROTEAN Tetra Cell Bio-Rad Cat# 1620264 Trans-Blot Turbo Transfer System Bio-Rad Cat# 1704150 Bio-Spin P-6 gel Columns, Tris Buffer Bio-Rad Cat# 7326227 Mouse stereotaxic Frame Stoelting Cat# 51730U Nanoliter Injector World Precision Instruments Cat# NL2010MC2T LS columns Miltenyi Biotec Cat# 130-042-401 QuadroMACS magnet Miltenyi Biotec Cat# 130-091-051 Gallios Flow Cytometer - Navios System Beckman Coulter Cat# B83535 Bio-Plex 200 System Bio-Rad https://www.bio-rad.com/en- us/product/bio-plex-200-systems Keyence BZ-X810 Microscope Keyence https://www.keyence.com/landing/ lpc/all-in-one-fluorescencemicroscope.jsp Cellometer Auto 2000 Nexelcom Bioscience https://www.nexcelom.com/ nexcelom-products/cellometerfluorescent-viability-cell-counters/ cellometer-auto-2000/ NanoDrop 2000 Spectrophotometer Thermo Fisher Scientific https://www.thermofisher.com/ order/catalog/product/ND-2000 CFX384 Real-Time PCR System Bio-Rad Cat# 1855484 Influx Cell Sorter BD https://med.virginia.edu/flow- cytometry-facility/equipment/ influx-cell-sorter/ GENEWIZ Next Generation Sequencing Azenta https://www.genewiz.com/en/ Public/Services/Sanger-Sequencing ChemiDoc MP Imaging System Bio-Rad Cat# 12003154 ll OPEN ACCESSArticle

    other:

    Article Title: Molecular insights into the activation of Mre11-Rad50 endonuclease activity by Sae2/CtIP.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Saccharomyces cerevisiae This study Listed in Table S6 Bacterial and virus strains E.coli: DH10B Thermo Fisher Scientific Cat# EC0113 E.coli: DH10Bac Thermo Fisher Scientific Cat # 10361012 E.coli: BL21(DE3)pLysS Competent Cells Promega Cat# L1195 E.coli: Rosetta2(DE3)pLysS Competent Cells Novagen, Merck Millipore Cat# 71403 Chemicals, peptides, and recombinant proteins Protease Inhibitor Cocktail Sigma Cat#P8340 Ni-NTA Agarose Qiagen Cat# 30250 Anti-FLAG M2 affinity gel Sigma-Aldrich Cat# A2220; RRID:AB_10063035 Anti-FLAG M2 antibody Sigma-Aldrich Cat# F3165; RRID: AB_259529 Amylose resin New England Biolabs Cat# E8021L Phenylmethanesulfonyl fluoride Sigma Cat# 78830 Dynabeads Protein G Thermo Fisher Scientific Cat# 10003D [alpha-P32]Deoxycytidine 50-triphosphate (dCTP) Hartmann Analytic Cat# SRP-205 [alpha-P32]Deoxycytidine 50-triphosphate (dCTP) Revvity SAS Cat# BLU513Z500UC Pyruvate Kinase from rabbit muscle Sigma-Aldrich Cat# P1506 Proteinase K, recombinant, PCR Grade Sigma-Aldrich Cat# 3115828001 RNase A Sigma-Aldrich Cat# 11119915001 Zymolase 20T MP Biochemicals Cat# 08320921 Zymolase 100T MP Biochemicals Cat# 08320932 XhoI New England Biolabs Cat# R0146S Flag Peptide GLPBIO Cat# GP10149 Terminal Transferase New England Biolabs Cat# M0315 Terminal Transferase Thermo Fisher Scientific Cat# EP0162 Phusion High-Fidelity DNA Polymerase New England Biolabs Cat# M0530 Monovalent Streptavidin Gift from M. Howarth, University of Oxford58 N/A Native Mark Protein Standard Invitrogen Cat# LC0725 Amersham Hybond-XL nylon membrane Fisher Scientific Cat# 45001148 Lambda Phosphatase New England Biolabs Cat# P0753S Critical commercial assays TransIT-Insect Transfection Reagent Mirus bio Cat# MIR6100 Site-Directed Mutagenesis QuikChange II Agilent Cat# 200523 QIAquick PCR Purification Kit QIAGEN Cat# 28104 QIAquick Gel Extraction Kit QIAGEN Cat# 28706 QIAprep Spin Miniprep Kit QIAGEN Cat# 27106 QIAGEN Plasmid Mini Kit QIAGEN Cat# 27106 Bac-to-Bac Baculovirus Expression System Invitrogen Cat# 10359-016 Micro Bio-Spin P-30 gel columns, Tris buffer BIO-RAD Cat# 7326223 High Prime Sigma-Aldrich Cat# 11585592001 Deposited data Representative Relaxed Structural Models This study Listed in Table S5 All Unrelaxed Structural Models (25 per systems) This study https://zenodo.org/doi/ 10.5281/zenodo.11186972 (Continued on next page) e1 Molecular Cell 84, 2223–2237.e1–e4, June 20, 2024

    Article Title: A CDK11-dependent RNA polymerase II pause-checkpoint precedes CDK9-mediated transition to transcriptional elongation
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER μMACS Streptavidin Kit Miltenyi Biotec Cat#130-074-101 NucleoSpin Gel and PCR Clean-up Mini kit Macherey-Nagel Cat#740609 NucleoSpin Plasmid Mini kit Macherey-Nagel Cat#740588 Deposited data RNA-seq data This paper GSE280102 ChIP-seq data This paper GSE280208 PRO- and TT-seq data This paper GSE280103 Mass spectrometry data This paper PXD066230 Experimental models: Cell lines Human: THP-1 American Type Cell Culture® (ATCC®) Cat#TIB-202; RRID: CVCL_0006 Human: MV4;11 ATCC® Cat#CRL-9591; RRID: CVCL_0064 Human: BJ-T ATCC® Cat#CRL-2522; RRID: CVCL_6573 Human: MM1.S ATCC® Cat#CRL-2974; RRID: CVCL_8792 Human: OCI-AML3 German Collection of Microorganisms and Cell Cultures GmbH (DSMZ) Cat#ACC 582; RRID: CVCL_1844 Human: HEK293T ATCC® Cat#CRL-11268; RRID: CVCL_0063 Human: HCT116 ATCC® Cat#CCL-247; RRID: CVCL_0291 Drosophila melanogaster: S2 ATCC® Cat#CRL-1963; RRID: CVCL_Z232 Murine: Mll-Af9 Nras G12D mCherry Baker et al., 30 ; Peter MacCallum Cancer Centre N/A Murine: Eμ-Myc 4242/3.2 Shortt et al., 103 ; Peter MacCallum Cancer Centre N/A Murine: Eμ-Myc 6066/2.1 Shortt et al., 103 ;Peter MacCallum Cancer Centre N/A Murine: Eμ-Myc 299/2.1 Shortt et al., 103 ; Peter MacCallum Cancer Centre N/A Spodoptera frugiperda: Sf21 Professor Mark Hogarth, Burnet Institute, Melbourne VIC 3000, Australia RRID: CVCL_0518 Experimental models: Organisms/strains Mice: C57Bl/6 The Walter and Eliza Hall Institute, Melbourne VIC 3000, Australia N/A Oligonucleotides Scrambled (SCR) sgRNA for Human cells GCCTAGTCTCGGTAAGAGTG Doench et al. 104 Non-Targeting Control sgRNA targeting Human CDK11A/B (for CDK11A/B knockout)sense: TCCCAC ATCACCGAACGATGAGAGantisense: AAACCTCTCATCGTTCGGTGATGT Doench et al. 104 ID_2782 sgRNA targeting Human CDK11B (for CDK11B G579S homology-directed-repair) GGGTGACTTCGGGCTGGCGC This paper N/A DNA donor template for Human CDK11B G579S mutationAGCCACGCCGGCATCCTCAAG GTGAGCCCCCCTCCGAGTGGCCCATC CCAGGGAGACCTGCCGGGGCCCACTC ACAGCCGCCCATCTGTCGTTGCAGGTG AGTGATTTTGGACTGGCGCGGGAGTAC GGATCCCCTCTGAAGGCCTACACCCCG GTCGTGGTGACCCTGTGGTACCGCGCC CCAGAGCTGCTGCTTGGTG This paper N/A (Continued on next page) ll OPEN ACCESSArticle Molecular Cell 85, 1–20.e1–e13, September 4, 2025 e3

    Software:

    Article Title: A framework to validate fluorescently labeled DNA-binding proteins for single-molecule experiments.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER His6-SUMO-BsParB(WT) amp Graham et al.23 pTG011 (=m0041) pelB::Psoj-spo0J-R80A(DparS)-mgfpmut3 tet This paper pWX1104 His6-SUMO-BsParB(R80A) amp Graham et al.23 pTG037 (=m0042) His6-SUMO-KCK-BsParB(WT) amp Graham et al.23 pTG042 (=m0043) His6-SUMO-KCK-BsParB(R80A) amp Graham et al.23 pTG044 (=m0044) His6-SUMO-ECE-BsParB(WT) amp This paper m0064 His6-SUMO-BsParB(WT)-KCK amp This paper m0067 His6-SUMO-BsParB(R80A)-KCK amp This paper m0069 His6-SUMO-ECE-BsParB(R80A) amp This paper m0070 pelB::Psoj-soj-spo0J-R80A(DparS) cat Graham et al.23 pTG122 Software and algorithms MicroManager Edelstein et al.60 https://micro-manager.org Fiji Schindelin et al.61 https://imagej.net/Fiji MATLAB codes used in single-molecule data analyses Kim et al.14 N/A MetaMorph Molecular Devices https://www.moleculardevices.com/ AlphaView ProteinSimple https://proteinsimple.jp/imaging-crunch- some-numbers CLC Genomics Workbench Qiagen https://www.qiagen.com/us/products/discovery- and-translational-research/next-generationsequencing/informatics-and-data/analysisand-visualization/clc-genomics-workbench Other Lambda DNA (dam-) New England Biolabs Cat#N3013S Micro Bio-Spin P-30 Gel Columns, Tris Buffer Bio-Rad Cat7326223 IX-83 total internal reflection fluorescence (TIRF) microscope Olympus (Evident) https://www.olympus-lifescience.com/ Ti2 microscope Nikon instruments https://www.microscope.healthcare.nikon.com/ OptoSplit II Cairn Research https://www.cairn-research.co.uk/product/ optosplit-ii/ T660lpxrxt (Dichroic) Chroma Technology Corp. https://www.chroma.com/ ET705/72m (Emission filter) Chroma Technology Corp. https://www.chroma.com/ ET585/65m (Emission filter) Chroma Technology Corp. https://www.chroma.com/ Q800R2 water bath sonicator Qsonica https://www.sonicator.com/ ProteinSimple Fluorchem R system Bio-Techne https://www.bio-techne.com/p/imaging/ fluorchem-r-system_92-15313-00 UVP UVsolo touch gel documentation system Analytik Jena https://www.analytik-jena.com/ NextSeq 500 System WGS Solution Illumina https://www.illumina.com/ Protein A magnetic Sepharose beads Cytiva Cat#28951378 4-15% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat#4561086 4-20% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat#4561096 Trans-Blot Turbo Mini 0.2 mm PVDF Transfer Packs Bio-Rad Cat#1704156 ..


    Lambda DNA Preparation:

    Article Title: A framework to validate fluorescently labeled DNA-binding proteins for single-molecule experiments.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER His6-SUMO-BsParB(WT) amp Graham et al.23 pTG011 (=m0041) pelB::Psoj-spo0J-R80A(DparS)-mgfpmut3 tet This paper pWX1104 His6-SUMO-BsParB(R80A) amp Graham et al.23 pTG037 (=m0042) His6-SUMO-KCK-BsParB(WT) amp Graham et al.23 pTG042 (=m0043) His6-SUMO-KCK-BsParB(R80A) amp Graham et al.23 pTG044 (=m0044) His6-SUMO-ECE-BsParB(WT) amp This paper m0064 His6-SUMO-BsParB(WT)-KCK amp This paper m0067 His6-SUMO-BsParB(R80A)-KCK amp This paper m0069 His6-SUMO-ECE-BsParB(R80A) amp This paper m0070 pelB::Psoj-soj-spo0J-R80A(DparS) cat Graham et al.23 pTG122 Software and algorithms MicroManager Edelstein et al.60 https://micro-manager.org Fiji Schindelin et al.61 https://imagej.net/Fiji MATLAB codes used in single-molecule data analyses Kim et al.14 N/A MetaMorph Molecular Devices https://www.moleculardevices.com/ AlphaView ProteinSimple https://proteinsimple.jp/imaging-crunch- some-numbers CLC Genomics Workbench Qiagen https://www.qiagen.com/us/products/discovery- and-translational-research/next-generationsequencing/informatics-and-data/analysisand-visualization/clc-genomics-workbench Other Lambda DNA (dam-) New England Biolabs Cat#N3013S Micro Bio-Spin P-30 Gel Columns, Tris Buffer Bio-Rad Cat7326223 IX-83 total internal reflection fluorescence (TIRF) microscope Olympus (Evident) https://www.olympus-lifescience.com/ Ti2 microscope Nikon instruments https://www.microscope.healthcare.nikon.com/ OptoSplit II Cairn Research https://www.cairn-research.co.uk/product/ optosplit-ii/ T660lpxrxt (Dichroic) Chroma Technology Corp. https://www.chroma.com/ ET705/72m (Emission filter) Chroma Technology Corp. https://www.chroma.com/ ET585/65m (Emission filter) Chroma Technology Corp. https://www.chroma.com/ Q800R2 water bath sonicator Qsonica https://www.sonicator.com/ ProteinSimple Fluorchem R system Bio-Techne https://www.bio-techne.com/p/imaging/ fluorchem-r-system_92-15313-00 UVP UVsolo touch gel documentation system Analytik Jena https://www.analytik-jena.com/ NextSeq 500 System WGS Solution Illumina https://www.illumina.com/ Protein A magnetic Sepharose beads Cytiva Cat#28951378 4-15% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat#4561086 4-20% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat#4561096 Trans-Blot Turbo Mini 0.2 mm PVDF Transfer Packs Bio-Rad Cat#1704156 ..

    Fluorescence:

    Article Title: A framework to validate fluorescently labeled DNA-binding proteins for single-molecule experiments.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER His6-SUMO-BsParB(WT) amp Graham et al.23 pTG011 (=m0041) pelB::Psoj-spo0J-R80A(DparS)-mgfpmut3 tet This paper pWX1104 His6-SUMO-BsParB(R80A) amp Graham et al.23 pTG037 (=m0042) His6-SUMO-KCK-BsParB(WT) amp Graham et al.23 pTG042 (=m0043) His6-SUMO-KCK-BsParB(R80A) amp Graham et al.23 pTG044 (=m0044) His6-SUMO-ECE-BsParB(WT) amp This paper m0064 His6-SUMO-BsParB(WT)-KCK amp This paper m0067 His6-SUMO-BsParB(R80A)-KCK amp This paper m0069 His6-SUMO-ECE-BsParB(R80A) amp This paper m0070 pelB::Psoj-soj-spo0J-R80A(DparS) cat Graham et al.23 pTG122 Software and algorithms MicroManager Edelstein et al.60 https://micro-manager.org Fiji Schindelin et al.61 https://imagej.net/Fiji MATLAB codes used in single-molecule data analyses Kim et al.14 N/A MetaMorph Molecular Devices https://www.moleculardevices.com/ AlphaView ProteinSimple https://proteinsimple.jp/imaging-crunch- some-numbers CLC Genomics Workbench Qiagen https://www.qiagen.com/us/products/discovery- and-translational-research/next-generationsequencing/informatics-and-data/analysisand-visualization/clc-genomics-workbench Other Lambda DNA (dam-) New England Biolabs Cat#N3013S Micro Bio-Spin P-30 Gel Columns, Tris Buffer Bio-Rad Cat7326223 IX-83 total internal reflection fluorescence (TIRF) microscope Olympus (Evident) https://www.olympus-lifescience.com/ Ti2 microscope Nikon instruments https://www.microscope.healthcare.nikon.com/ OptoSplit II Cairn Research https://www.cairn-research.co.uk/product/ optosplit-ii/ T660lpxrxt (Dichroic) Chroma Technology Corp. https://www.chroma.com/ ET705/72m (Emission filter) Chroma Technology Corp. https://www.chroma.com/ ET585/65m (Emission filter) Chroma Technology Corp. https://www.chroma.com/ Q800R2 water bath sonicator Qsonica https://www.sonicator.com/ ProteinSimple Fluorchem R system Bio-Techne https://www.bio-techne.com/p/imaging/ fluorchem-r-system_92-15313-00 UVP UVsolo touch gel documentation system Analytik Jena https://www.analytik-jena.com/ NextSeq 500 System WGS Solution Illumina https://www.illumina.com/ Protein A magnetic Sepharose beads Cytiva Cat#28951378 4-15% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat#4561086 4-20% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat#4561096 Trans-Blot Turbo Mini 0.2 mm PVDF Transfer Packs Bio-Rad Cat#1704156 ..

    Whole Complete genome sequencing:

    Article Title: A framework to validate fluorescently labeled DNA-binding proteins for single-molecule experiments.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER His6-SUMO-BsParB(WT) amp Graham et al.23 pTG011 (=m0041) pelB::Psoj-spo0J-R80A(DparS)-mgfpmut3 tet This paper pWX1104 His6-SUMO-BsParB(R80A) amp Graham et al.23 pTG037 (=m0042) His6-SUMO-KCK-BsParB(WT) amp Graham et al.23 pTG042 (=m0043) His6-SUMO-KCK-BsParB(R80A) amp Graham et al.23 pTG044 (=m0044) His6-SUMO-ECE-BsParB(WT) amp This paper m0064 His6-SUMO-BsParB(WT)-KCK amp This paper m0067 His6-SUMO-BsParB(R80A)-KCK amp This paper m0069 His6-SUMO-ECE-BsParB(R80A) amp This paper m0070 pelB::Psoj-soj-spo0J-R80A(DparS) cat Graham et al.23 pTG122 Software and algorithms MicroManager Edelstein et al.60 https://micro-manager.org Fiji Schindelin et al.61 https://imagej.net/Fiji MATLAB codes used in single-molecule data analyses Kim et al.14 N/A MetaMorph Molecular Devices https://www.moleculardevices.com/ AlphaView ProteinSimple https://proteinsimple.jp/imaging-crunch- some-numbers CLC Genomics Workbench Qiagen https://www.qiagen.com/us/products/discovery- and-translational-research/next-generationsequencing/informatics-and-data/analysisand-visualization/clc-genomics-workbench Other Lambda DNA (dam-) New England Biolabs Cat#N3013S Micro Bio-Spin P-30 Gel Columns, Tris Buffer Bio-Rad Cat7326223 IX-83 total internal reflection fluorescence (TIRF) microscope Olympus (Evident) https://www.olympus-lifescience.com/ Ti2 microscope Nikon instruments https://www.microscope.healthcare.nikon.com/ OptoSplit II Cairn Research https://www.cairn-research.co.uk/product/ optosplit-ii/ T660lpxrxt (Dichroic) Chroma Technology Corp. https://www.chroma.com/ ET705/72m (Emission filter) Chroma Technology Corp. https://www.chroma.com/ ET585/65m (Emission filter) Chroma Technology Corp. https://www.chroma.com/ Q800R2 water bath sonicator Qsonica https://www.sonicator.com/ ProteinSimple Fluorchem R system Bio-Techne https://www.bio-techne.com/p/imaging/ fluorchem-r-system_92-15313-00 UVP UVsolo touch gel documentation system Analytik Jena https://www.analytik-jena.com/ NextSeq 500 System WGS Solution Illumina https://www.illumina.com/ Protein A magnetic Sepharose beads Cytiva Cat#28951378 4-15% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat#4561086 4-20% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad Cat#4561096 Trans-Blot Turbo Mini 0.2 mm PVDF Transfer Packs Bio-Rad Cat#1704156 ..

    Membrane:

    Article Title: Emulsion separation and fouling of electrospun polyacrylonitrile membranes for produced water applications
    Article Snippet: ll OPEN ACCESS iScience

    Recombinant:


    Sequencing:




    Similar Products

    99
    Bio-Rad recombinant proteins 10× tris buffered saline tbs bio rad
    Recombinant Proteins 10× Tris Buffered Saline Tbs Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/TBS+%2C+Buffer+Tris+Salino/pm42097146-234-8-14
    Average 99 stars, based on 1 article reviews
    recombinant proteins 10× tris buffered saline tbs bio rad - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    97
    Bio-Rad bio rad tris glycine buffer
    Bio Rad Tris Glycine Buffer, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/Glycine/pm41917326-357-19-19
    Average 97 stars, based on 1 article reviews
    bio rad tris glycine buffer - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    98
    Bio-Rad t6399 tris buffered saline tbs bio rad laboratories
    T6399 Tris Buffered Saline Tbs Bio Rad Laboratories, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/Tris/pm41824455-337-47-52
    Average 98 stars, based on 1 article reviews
    t6399 tris buffered saline tbs bio rad laboratories - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    98
    Bio-Rad bio rad tris gly cine buffer
    Bio Rad Tris Gly Cine Buffer, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/Tris/pm41765286-126-37-41
    Average 98 stars, based on 1 article reviews
    bio rad tris gly cine buffer - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    94
    Bio-Rad tris glycine buffer 10 x bio rad
    Tris Glycine Buffer 10 X Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/10x+Tris%2FTricine%2FSDS+Running+Buffer/pm41758652-248-23-27
    Average 94 stars, based on 1 article reviews
    tris glycine buffer 10 x bio rad - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    96
    Bio-Rad bio rad 10x tris glycine sds buffer 5 l
    Bio Rad 10x Tris Glycine Sds Buffer 5 L, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/10x+Tris%2FGlycine%2FSDS/pmc12857400-47-0-0
    Average 96 stars, based on 1 article reviews
    bio rad 10x tris glycine sds buffer 5 l - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Bio-Rad 10x tris glycine sds running buffer bio rad
    10x Tris Glycine Sds Running Buffer Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/10x+Tris%2FGlycine%2FSDS/pm41575844-43-22-26
    Average 96 stars, based on 1 article reviews
    10x tris glycine sds running buffer bio rad - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    98
    Bio-Rad bio rad 10 × tris buffered saline tbs
    Bio Rad 10 × Tris Buffered Saline Tbs, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/Tris/pmc13174197-109-12-12
    Average 98 stars, based on 1 article reviews
    bio rad 10 × tris buffered saline tbs - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    99
    Bio-Rad v v tween 20 bio rad cat no 170631
    V V Tween 20 Bio Rad Cat No 170631, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/TBS+%2C+Buffer+Tris+Salino/pmc12862372-112-12-15
    Average 99 stars, based on 1 article reviews
    v v tween 20 bio rad cat no 170631 - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    96
    Bio-Rad tris buffer bio rad
    Tris Buffer Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tris+buffer+bio+rad/Micro+Bio-Spin+P-6+Gel+Columns/pm41380686-316-189-191
    Average 96 stars, based on 1 article reviews
    tris buffer bio rad - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results